UTRScan Help

UTRScan output example:


================================================================================
               UtrScan
================================================================================

--------------------------------------------------------------------------------
U0001 - HSL3            - Histone 3'UTR stem-loop structure (HSL3)
U0002 - IRE             - Iron Responsive Element (IRE)
U0003 - SECIS1          - Selenocysteine Insertion Sequence - type 1 (SECIS1)
U0004 - SECIS2          - Selenocysteine Insertion Sequence - type 2 (SECIS2)
U0005 - APP_SCE         - Amyloid precursor protein mRNA stability control element (APP_SCE)
U0006 - CPE             - Cytoplasmic polyadenylation element (CPE)
U0007 - TGE             - TGE translational regulation element (TGE)
U0008 - NANOS_TCE       - Nanos translation control element (NANOS_TCE)
U0009 - 15-LOX-DICE     - 15-Lipoxygenase Differentiation Control Element (15-LOX-DICE)
U0010 - ARE2            - AU-rich class-2 Element (ARE2)
U0011 - TOP             - Terminal Oligopyrimidine Tract (TOP)
U0012 - GLUT1           - Glusose transporter type-1 3'UTR cis-acting element (GLUT1)
U0013 - TNF             - Tumor necrosis factor alpha 3'UTR cis-acting element (TNF)
U0014 - VIM3            - Vimentin 3'UTR cis-acting element (VIM3)
U0015 - IRES            - Internal Ribosome Entry Site (IRES)
U0016 - SXL_BS          - SXL binding site
U0017 - UNR-bs          - UNR binding site
U0018 - RPMS12_TCE      - Ribosomal S12 mitochondrial protein 5'UTR translation control element (RPMS12_TCE)
U0019 - BRE             - Bruno 3'UTR responsive element (BRE)
U0020 - ADH_DRE         - Alcohol dehydrogenase 3'UTR downregulation control element (ADH_DRE)
U0021 - BYDV_TE         - Barley yellow dwarf virus translation control element (BYDV_TE)
U0022 - PRONEURAL-BOX   - Proneural Box (PB)
U0023 - K-BOX           - K-Box (KB)
U0024 - BRD-BOX         - Brd-Box (Brd)
U0025 - GY-BOX          - GY-Box (GY)
U0026 - AR_CURE         - Androgen receptor CU-rich element (AR_CURE)
U0027 - G3A             - Elastin G3A 3'UTR stability motif (G3A)
U0028 - INS_SCE         - Insulin 3'UTR stability element (INS_SCE)
U0029 - ACTIN_ZIP3      - Beta-actin 3'UTR zipcode (ACTIN_ZIP3)
U0030 - GAP-43          - Gap-43 Stabilization Element (GAP-43)
U0031 - CNDLE           - CaMKII/Ng dendritic localization element (CNDLE)
U0033 - uORF            - Upstream Open Reading Frame (uORF)
U0032 - AG-CRSD         - alpha-globin 3'UTR C-rich stability determinant (AG-CRSD)
U0034 - GAIT            - Gamma interferon activated inhibitor of translation (GAIT element)
U0035 - Mos-PRE         - Mos polyadenylation response element (Mos-PRE)
U0036 - HLE             - Drosophila hairy mRNA localization element (HLE)
U0037 - MBP-A2RE11      - Myelin Basic Protein Localization Element (MBP-A2RE11)
U0038 - Protamine-YRS   - Protamine P1 3'UTR Y-Box recognition site (Protamine-YRS)
U0039 - G-CSF_SLDE      - Granulocyte colony-stimulating factor stem-loop destabilizing element (G-CSF_SLDE)
U0040 - Ren_SRE         - Renin stability regulatory element (Ren_SRE)
U0041 - PTH1            - PTH 3'UTR proximal cis-acting instability element (PTH1)
U0042 - PTH2            - PTH 3'UTR distal cis-acting instability element (PTH2)
U0043 - PAS             - Polyadenylation Signal (PAS)
U0044 - PABP_ARS        - PABP mRNA autoregulatoy repression sequence
U0045 - ApoB            - ApoB 5'UTR cis-acting regulatory element
U0046 - TPP_riboswitch  - Thiamin pyrophosphate riboswitch (TPP_riboswitch)
--------------------------------------------------------------------------------

Sequence1 136 : TOP [1,5] :  c ttt g
Sequence1 136 : uORF [11,121] : atg gcatttgaaatctccaactcagacacaccagattgcacccatcatccaagatgaagactcctaagcttgataaattccactgacaaaacaaaccaacaaagcaaa taa
Sequence1 136 : PAS [117,136] : aataaa ctgatatgatcaaa

--------------------------------------------------------------------------------
Match Total = 3                         Signal Total = 3
--------------------------------------------------------------------------------

================================================================================
Sequences = 1
================================================================================

In this example found three elements found, where the in first match:

Sequence1 is the name of your input sequence

136 is the sequence length

TOP is the UTRSite signal (the regulatory element)

[1,5] are the start and end positions of signal inside the sequence

the last field is the matched nucleotide sequence along the sequence